ID: 1163908022_1163908027

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1163908022 1163908027
Species Human (GRCh38) Human (GRCh38)
Location 19:20164587-20164609 19:20164613-20164635
Sequence CCCAGTAGAAAAAAAGAAATAAC GATCAGAGCAGAACCCTAGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!