ID: 1163908679_1163908687

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1163908679 1163908687
Species Human (GRCh38) Human (GRCh38)
Location 19:20169486-20169508 19:20169526-20169548
Sequence CCATGGAAGGAGCCTTTATCCTG CTGGAAAGCTGGAGCCCCACAGG
Strand - +
Off-target summary No data {0: 2, 1: 5, 2: 12, 3: 50, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!