ID: 1163916782_1163916788

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1163916782 1163916788
Species Human (GRCh38) Human (GRCh38)
Location 19:20247058-20247080 19:20247097-20247119
Sequence CCTTTTTAACCCTCCAAGTGCAT AAACAGGCCTGTTAAACTCTGGG
Strand - +
Off-target summary {0: 6, 1: 30, 2: 20, 3: 28, 4: 144} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!