ID: 1163916783_1163916786

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1163916783 1163916786
Species Human (GRCh38) Human (GRCh38)
Location 19:20247067-20247089 19:20247081-20247103
Sequence CCCTCCAAGTGCATAAAGCATTA AAAGCATTATATAAAGAAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 3, 3: 74, 4: 744}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!