ID: 1163916784_1163916787

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1163916784 1163916787
Species Human (GRCh38) Human (GRCh38)
Location 19:20247068-20247090 19:20247096-20247118
Sequence CCTCCAAGTGCATAAAGCATTAT GAAACAGGCCTGTTAAACTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 35, 4: 166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!