ID: 1163933800_1163933803 |
View in Genome Browser |
Spacer: -2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1163933800 | 1163933803 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 19:20423786-20423808 | 19:20423807-20423829 |
| Sequence | CCCTAAGGCAGTTTTGTTTTTGT | GTGTTCTTCCCCTATTGCCTGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 2, 2: 64, 3: 262, 4: 464} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||