ID: 1163935512_1163935515

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1163935512 1163935515
Species Human (GRCh38) Human (GRCh38)
Location 19:20439020-20439042 19:20439046-20439068
Sequence CCTGCTAGGGTTCTGCTCTGATC GTTATTTCTTTTTTTCTGCTGGG
Strand - +
Off-target summary No data {0: 13, 1: 252, 2: 667, 3: 714, 4: 2034}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!