ID: 1163979377_1163979384

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1163979377 1163979384
Species Human (GRCh38) Human (GRCh38)
Location 19:20884496-20884518 19:20884546-20884568
Sequence CCTGTTCGTTGTCACCCAATCAT CACCCACAAGGTCATTAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 58, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!