ID: 1164017081_1164017084

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1164017081 1164017084
Species Human (GRCh38) Human (GRCh38)
Location 19:21262678-21262700 19:21262696-21262718
Sequence CCTGCTCTGACCACTCTGGAGGC GAGGCTGGTCAGTCTACACACGG
Strand - +
Off-target summary {0: 2, 1: 10, 2: 13, 3: 30, 4: 231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!