ID: 1164029230_1164029233

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1164029230 1164029233
Species Human (GRCh38) Human (GRCh38)
Location 19:21386210-21386232 19:21386226-21386248
Sequence CCCCTCAACTTTCTGCACATAAG ACATAAGATAATTTATACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 248} {0: 2, 1: 8, 2: 15, 3: 48, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!