ID: 1164052158_1164052163

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1164052158 1164052163
Species Human (GRCh38) Human (GRCh38)
Location 19:21592839-21592861 19:21592853-21592875
Sequence CCACAGAACACCCTGTGCCTGGG GTGCCTGGGGACCCCAGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 31, 4: 297} {0: 1, 1: 0, 2: 2, 3: 51, 4: 721}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!