ID: 1164052158_1164052165

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1164052158 1164052165
Species Human (GRCh38) Human (GRCh38)
Location 19:21592839-21592861 19:21592862-21592884
Sequence CCACAGAACACCCTGTGCCTGGG GACCCCAGCCCCGGCTCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 31, 4: 297} {0: 1, 1: 0, 2: 5, 3: 45, 4: 493}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!