ID: 1164100696_1164100704

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1164100696 1164100704
Species Human (GRCh38) Human (GRCh38)
Location 19:22052256-22052278 19:22052296-22052318
Sequence CCTTTGGGTTGGGCCTGGCTCAG GCCTGAAAAGGCTGGAGCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 206} {0: 1, 1: 7, 2: 13, 3: 22, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!