ID: 1164167496_1164167501

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1164167496 1164167501
Species Human (GRCh38) Human (GRCh38)
Location 19:22694985-22695007 19:22695020-22695042
Sequence CCACCTTCCCTGGCTAATTTTAG GAGACGAGGTTTCGCCGTTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 446, 3: 24896, 4: 94037} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!