ID: 1164167685_1164167689

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1164167685 1164167689
Species Human (GRCh38) Human (GRCh38)
Location 19:22696998-22697020 19:22697037-22697059
Sequence CCAGATTCACTAAGTATCTAGCC AATTAAGTCAAGATCCTAACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!