ID: 1164179638_1164179653

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1164179638 1164179653
Species Human (GRCh38) Human (GRCh38)
Location 19:22807476-22807498 19:22807518-22807540
Sequence CCCGCTGGTTCCTCCCCACTCGC GCTCTGTGGCCCGGGCTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 224} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!