ID: 1164196820_1164196827

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1164196820 1164196827
Species Human (GRCh38) Human (GRCh38)
Location 19:22974877-22974899 19:22974913-22974935
Sequence CCCTAGACAGTCTCCCTCTGTTG AAATGCTTTCCTTTGCAATTAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 12, 3: 66, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!