ID: 1164243391_1164243402

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1164243391 1164243402
Species Human (GRCh38) Human (GRCh38)
Location 19:23409714-23409736 19:23409762-23409784
Sequence CCCAAGGCGGCCCACCTCCGCAG CTTCCTAAGCTTTGAATCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 14, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!