ID: 1164249211_1164249215

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1164249211 1164249215
Species Human (GRCh38) Human (GRCh38)
Location 19:23462273-23462295 19:23462320-23462342
Sequence CCTTCAACTTGCCAATGAGAGAG AAGGAAAAAGATAAGATCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 62, 4: 659}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!