ID: 1164282028_1164282037

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1164282028 1164282037
Species Human (GRCh38) Human (GRCh38)
Location 19:23777534-23777556 19:23777570-23777592
Sequence CCTGACACCTAGGGGATGAGAGA CCTGCCCACAGGATGCTTTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 30, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!