ID: 1164286080_1164286082

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1164286080 1164286082
Species Human (GRCh38) Human (GRCh38)
Location 19:23819001-23819023 19:23819040-23819062
Sequence CCCTTTAACGTGGTTAAAGGGAA TAACATGTTTATACCTAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 77} {0: 1, 1: 0, 2: 2, 3: 12, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!