ID: 1164388036_1164388041

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1164388036 1164388041
Species Human (GRCh38) Human (GRCh38)
Location 19:27793693-27793715 19:27793719-27793741
Sequence CCGCAGTGGACGCGTGGAGGGGC GTAGAGGAGGGACCTTTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 81} {0: 1, 1: 2, 2: 1, 3: 13, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!