ID: 1164393796_1164393805

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1164393796 1164393805
Species Human (GRCh38) Human (GRCh38)
Location 19:27846781-27846803 19:27846832-27846854
Sequence CCGCATCCTATAACTGTCTGGAC CAGGGGTTTGTCTTTTGCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 53, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!