ID: 1164398221_1164398227

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1164398221 1164398227
Species Human (GRCh38) Human (GRCh38)
Location 19:27884762-27884784 19:27884802-27884824
Sequence CCCTTTATCCTCAGTAACAGCAC GATGTCCTCACAGCTGAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!