ID: 1164411396_1164411402

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1164411396 1164411402
Species Human (GRCh38) Human (GRCh38)
Location 19:28008795-28008817 19:28008828-28008850
Sequence CCCAGAAGATCAGCTGGCTTTAC CAGTATGCAAAGAGCCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 33, 3: 357, 4: 805} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!