ID: 1164515724_1164515727

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1164515724 1164515727
Species Human (GRCh38) Human (GRCh38)
Location 19:28933809-28933831 19:28933836-28933858
Sequence CCTCCAATCAGTCACTGTAGGCT CTGCCTACAGAAATGAAGCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!