ID: 1164576260_1164576270

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1164576260 1164576270
Species Human (GRCh38) Human (GRCh38)
Location 19:29407117-29407139 19:29407170-29407192
Sequence CCTCACACTCTCTGCCTTCTCTT CCTGGCTCCCCCGATCCCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 93, 4: 921} {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!