ID: 1164578721_1164578731

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1164578721 1164578731
Species Human (GRCh38) Human (GRCh38)
Location 19:29421225-29421247 19:29421264-29421286
Sequence CCAGTTTTAAACCTCTGATAATG GTGCAGACACGGCCTGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 195} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!