ID: 1164594846_1164594855

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1164594846 1164594855
Species Human (GRCh38) Human (GRCh38)
Location 19:29526107-29526129 19:29526138-29526160
Sequence CCGCGGAGGAACCGGCGGGGGCG AGCCGAAGGAGGTGGCAATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160} {0: 1, 1: 0, 2: 0, 3: 14, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!