ID: 1164594850_1164594857

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1164594850 1164594857
Species Human (GRCh38) Human (GRCh38)
Location 19:29526118-29526140 19:29526153-29526175
Sequence CCGGCGGGGGCGGCTGCGGGAGC CAATCGGGAGCAGAACCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 48, 4: 496} {0: 1, 1: 0, 2: 0, 3: 14, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!