ID: 1164594850_1164594860

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1164594850 1164594860
Species Human (GRCh38) Human (GRCh38)
Location 19:29526118-29526140 19:29526164-29526186
Sequence CCGGCGGGGGCGGCTGCGGGAGC AGAACCAGAAGGAGACAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 48, 4: 496} {0: 1, 1: 1, 2: 2, 3: 82, 4: 771}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!