ID: 1164602136_1164602142

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1164602136 1164602142
Species Human (GRCh38) Human (GRCh38)
Location 19:29569276-29569298 19:29569324-29569346
Sequence CCCACTTTGGGTGACACTGGGCA TGCAACTCCTGCTTTTCCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 33, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!