ID: 1164624795_1164624800

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1164624795 1164624800
Species Human (GRCh38) Human (GRCh38)
Location 19:29719035-29719057 19:29719063-29719085
Sequence CCACCTACTCGGGAGGCTGAGGC AGTCTCTTGAACTCGGGAGGTGG
Strand - +
Off-target summary {0: 911, 1: 100187, 2: 265964, 3: 218395, 4: 132820} {0: 4, 1: 115, 2: 3413, 3: 34856, 4: 104375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!