ID: 1164624795_1164624801

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1164624795 1164624801
Species Human (GRCh38) Human (GRCh38)
Location 19:29719035-29719057 19:29719066-29719088
Sequence CCACCTACTCGGGAGGCTGAGGC CTCTTGAACTCGGGAGGTGGAGG
Strand - +
Off-target summary {0: 911, 1: 100187, 2: 265964, 3: 218395, 4: 132820} {0: 25, 1: 1284, 2: 15264, 3: 63859, 4: 125260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!