ID: 1164624796_1164624799

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1164624796 1164624799
Species Human (GRCh38) Human (GRCh38)
Location 19:29719038-29719060 19:29719060-29719082
Sequence CCTACTCGGGAGGCTGAGGCAGA AAGAGTCTCTTGAACTCGGGAGG
Strand - +
Off-target summary {0: 69, 1: 1193, 2: 3067, 3: 3213, 4: 3449} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!