ID: 1164625197_1164625204

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1164625197 1164625204
Species Human (GRCh38) Human (GRCh38)
Location 19:29723258-29723280 19:29723279-29723301
Sequence CCAGGCTCAGAGTCTGGAACTGC GCTGATGGAGGGGCGGGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 301} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!