ID: 1164649666_1164649673

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1164649666 1164649673
Species Human (GRCh38) Human (GRCh38)
Location 19:29882758-29882780 19:29882789-29882811
Sequence CCCCGCTGGTGGGGAGAAAGGGC GTCTCATGGACCAGCCAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 177} {0: 1, 1: 0, 2: 0, 3: 27, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!