ID: 1164793646_1164793649

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1164793646 1164793649
Species Human (GRCh38) Human (GRCh38)
Location 19:31008814-31008836 19:31008836-31008858
Sequence CCAGAGAGTGAATAGCATCAGAA ATTGTCCTATTCTGAGGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 144} {0: 1, 1: 0, 2: 5, 3: 15, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!