ID: 1164887812_1164887821

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1164887812 1164887821
Species Human (GRCh38) Human (GRCh38)
Location 19:31797916-31797938 19:31797951-31797973
Sequence CCAAGCAAGAAGCCAGAGGTGGC CCTTCCAGGCACAGAGTGGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!