ID: 1164905754_1164905764

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1164905754 1164905764
Species Human (GRCh38) Human (GRCh38)
Location 19:31966644-31966666 19:31966694-31966716
Sequence CCCGGCAGGTACATGGCCCCACT AATGAATTACCTTCCTGGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!