ID: 1164907634_1164907636

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1164907634 1164907636
Species Human (GRCh38) Human (GRCh38)
Location 19:31980308-31980330 19:31980322-31980344
Sequence CCATCATTCTTCCGACTGTTCCA ACTGTTCCATGTTTCCCAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!