ID: 1164922890_1164922894

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1164922890 1164922894
Species Human (GRCh38) Human (GRCh38)
Location 19:32102908-32102930 19:32102928-32102950
Sequence CCTGCGCCTCCCTCACAATTTTC TTCCTGCCATTCTCCCACCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 152} {0: 1, 1: 0, 2: 8, 3: 70, 4: 905}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!