ID: 1164952088_1164952096

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1164952088 1164952096
Species Human (GRCh38) Human (GRCh38)
Location 19:32345529-32345551 19:32345565-32345587
Sequence CCGGGACGCCGGTAGGCGGGGCC GCCCCCGCTGCCCGCCATTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103} {0: 1, 1: 0, 2: 0, 3: 17, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!