ID: 1164986092_1164986102

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1164986092 1164986102
Species Human (GRCh38) Human (GRCh38)
Location 19:32649831-32649853 19:32649870-32649892
Sequence CCATTTACCACCTCAGCAGAACA GCTCCAGCTGGACACACAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 156} {0: 1, 1: 0, 2: 11, 3: 34, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!