ID: 1164990269_1164990275

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1164990269 1164990275
Species Human (GRCh38) Human (GRCh38)
Location 19:32677570-32677592 19:32677610-32677632
Sequence CCATTCGTCCCCAAGAGCAGCTA TGACCTCCCACTGCCGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87} {0: 1, 1: 0, 2: 0, 3: 20, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!