ID: 1165040472_1165040486

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1165040472 1165040486
Species Human (GRCh38) Human (GRCh38)
Location 19:33064706-33064728 19:33064732-33064754
Sequence CCCACGGCCCCTGCAGGGCCCGG AAAGGAGGTCTGGAGCCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 376} {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!