ID: 1165059133_1165059149

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1165059133 1165059149
Species Human (GRCh38) Human (GRCh38)
Location 19:33196197-33196219 19:33196249-33196271
Sequence CCCTCCTGCCTCTGCTGCTGCTG CCCTTCAAAGTTGTAGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 41, 3: 248, 4: 1183} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!