ID: 1165079804_1165079815

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1165079804 1165079815
Species Human (GRCh38) Human (GRCh38)
Location 19:33300808-33300830 19:33300831-33300853
Sequence CCCAAGTCCCTATGTTTCCACCC CTTTCTAAGGACAGGCGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 168} {0: 1, 1: 0, 2: 4, 3: 96, 4: 849}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!