ID: 1165141145_1165141159

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1165141145 1165141159
Species Human (GRCh38) Human (GRCh38)
Location 19:33700688-33700710 19:33700725-33700747
Sequence CCTAGGCCAGGCCAGCCATCATT GTGGGGAGGGGCAGAGAGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 42, 3: 496, 4: 3560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!