ID: 1165156692_1165156700

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1165156692 1165156700
Species Human (GRCh38) Human (GRCh38)
Location 19:33793069-33793091 19:33793099-33793121
Sequence CCCATGTTTCGTCACTCCCTTTA GATTCTCTGGGGTCCTAACTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!